Basrah Journal of Agricultural Sciences

Determination of the Optimal Spraying Application Rate for Improving the Vegetative Growth of Maize Crop Using Knapsack sprayer

Majid H. Alheidary — 2024-12-31

The most popular and efficient way for fertilization is soil application which needs to be applied in more significant quantities. Nevertheless, foliar fertilization is more practical and cost-effective in some situations. The main diagnostic methods for crop nutrients are foliar and soil fertilization tests to improve crop growth responses. Due to insufficient fertilizer application, particularly when utilizing the usual approach as a soil fertilizer addition, soil degradation will continue and become more expensive and impacting plant growth. To evaluate the influence on the maize vegetative growth, several NPK fertilizer levels were applied using foliar spraying, soil application and their combination treatments at different dosages. Experimental design was factorialal arrangement in a complete randomized block design (CRBD) with three replicates. Data analysis using Genstat softwar (Discovery edition3). The droplet properties such as volume median diameter, droplet deposition, uniformity, and coverage percentage are influenced by the layer of the plant canopy. In addition, the main growth characteristics of maize plants were measured. The upper layers of the plant canopy are the more in the spray deposition (0.529 µl.cm^-2), but the higher coverage percentage (33.36%) and the better deposition uniformity (5.54%) obtained in the bottom layers of the maize canopy. The findings demonstrate also a considerable increase in plant height, leaf number, leaf area, stem diameter, wet weight, dry weight, and percentage of N content in plants treated with foliar application and soil fertilization simultaneously (47.52cm, 14.98 leaf.plant^-1, 8077, 6.06cm, 52.13gm, 14.31gm, and 2.71%) respectively. The findings imply that soil fertilization and foliar spraying can be used to enhance maize growth.

Sonication Assisted Callus Growth, Protein Content, and Plant Regeneration of Silybum marianum L.

Shifa M. Salih — 2024-12-31

Silybum marianum L. is considered one of the most extensively used medicinal plants worldwide due to its therapeutic benefits. While ultrasound waves were used to enhance the properties of numerous plant species. However, no study was investigated on applying ultrasonic waves to this particular plant. Therefore, the study amid to assess the impact of different exposure periods (0,10, 20, 25, 30, 35, and 40 minutes) of a frequency of 47.6 KHz on callus induction, protein content, and plant regeneration in S. marianum. The effect of ultrasonication was distinctive in accelerating callus induction of S. marianum, especially in short exposing periods (10 and 20 minutes). The percentage of callus formation reached 100%, 83.3% for cotyledons and stem respectively, when exposed to 20 minutes of ultrasound. Additionally, growth and total protein content were increased at 40 days and 80 days post- treatments. In contrast, long exposing periods (30, 35, and 40 minutes) had a negative impact on callus induction from all explants, as well as on callus growth and protein content. Moreover, ultrasonication stimulated one-step shoot regeneration during callus induction. The percentage of this phenomenon reached 100% for cotyledon at 10 and 20 minutes exposing period. This study confirmed the advantages of applying ultrasonic waves, particularly during shorter period to enhance the cultivation of S. marianum in vitro.

The Effectiveness of Novel Growth Regulator and Fertilizer to Improve Quality and Yield of Spring Wheat

Shimendi G. Okbagabir — 2024-12-31

Reducing the use of chemical fertilizers is possible by implementing environmentally friendly smart farming technology like growth regulators and foliar fertilizer interactions. The experiment was entitled “Effectiveness of novel growth regulator and fertilizer to improve spring wheat quality and yield production.” The field was conducted at Barybino, Moscow Region in 2023. The experiment comprised 16 treatment combinations in Randomized Complete Block Design (RCBD) viz plant growth regulators (PGR) Centrino-1 (GR1), Centrino-2 (GR2), Centrino-3 (GR3), and Terrasay Fertilizer-1 (F1), Terrasay Fertilizer-2 (F2) and Terrasay-3 (F3) and Control (Co). The purpose of the research work was, to examine the effects of a new formulation of foliar fertilizer and PGR on the quality and productivity of spring wheat, and to determine the best way and right dosage levels of growth regulators and fertilizers to increase crop resistance, nutrient uptake efficiency of the crop. The results showed GR3F2 need-based led to the highest plant height (69.8cm) and leaf area (7.63 cm²). GR2F1 attained the highest number of tillers, root length, biological yield, grain yield, and gluten with a mean value of 3 tiller plant^-1, 10.7cm, 11118 kg ha^-1, 5042kg ha^-1 and 12.30 respectively. GR1F3 and GR2F2 recorded the highest in protein, and carbohydrate with a mean value of 9.63%, and 89% respectively. In conclusion, proficient handling of plant growth regulators (PGR) and fertilizers (F) can be considered as a crop management strategy to boost yield and quality by improving chemical fertilization, utilization efficiency, and reducing environmental pollution.

Improvement of Bacteriocin Production by Natural Zeolite and Detection of Antibacterial Activity of Leuconostoc carnosum Purified Carnosin

Haneen A. Ibrahim — 2024-12-31

The purpose of this study was the improvement of bacteriocin production due to importance of bacteriocin in biotechnology. Zeolite was used for the first time in this study to support and improvement of bacteriocin production through the ability to increase the bacterial biomass. Zeolite is a mineral that consists mainly of aluminosilicate. One –hundred eighty isolates belonging to the lactic acid bacteria were obtained from 120 samples of different parts of cauliflower and broccoli .The vegetable samples were taken from different markets in Baghdad city for 3 months. Lactic acid bacteria (LAB) isolates were identified by standard diagnostic methods. Bacteriocin production was detected by measuring the inhibition zone towards indicator pathogenic bacterial isolates. The isolates were screened to determine the most efficient producer which caused the largest inhibition zone and it chosen. The most efficient producer was Leuconostoc carnosum after confirmed identification using the VITEK®2 System. The results showed the maximum bacteriocin production with a specific activity of 1093 AU.mg^-1 protein when added 1.5%. The active peptide was purified from the cell-free supernatant of Leuconostoc carnosum in three processes: (1) Ammonium sulfate for precipitation with 40-60% saturation (2) ion-exchange chromatography (3) gel filtration chromatography. The purified carnosin was characterized by determining the molecular weight using SDS PAGE (8KDa) in size .Carnosin had lost antimicrobial activity with different protease treatments (pepsin, trypsin and proteinase K). Carnosin was maintained its activity at 100^oC but lost 13% of it at 121^oC after 15 min.; Carnosin resistance for changed in PH range of 2.0-11.0, while lost 15% of its activity at pH 12.0. Also the organic solvent, surfactant and metal ion salt do not effect on its activity. The purified carnosin appeared a board range of antimicrobial activity against many pathogenic and food-borne spoilage bacteria such as Escherichia coli, Pseudomonas aeruginosa, salmonella typhi, Listeria monocytogenes and Staphylococcus aureus.

Detection of Bioactive Compounds Produced by in Vitro Culture of Jojoba Plants (Simmondsia chinesi (Link) Schn.) Using GCMS and FTIR

Aman H. A. Althuluth — 2024-12-31

The jojoba tree is economically important plant due to its high contains of oil and its various industrial, commercial and medical applications. A practical experiment was carried out to determine the optimal combination of plant growth regulators affecting the response of transplanted buds to unfolding, growth and callus induction on the formed explants. The study was conducted in the Plant Tissue Culture laboratory at the College of Agriculture-University of Basrah. Apical shoots were used to produce the initial callus when cultured on MS nutrient medium with combinations of plant growth regulators (0.5, 1 and 2 mg L^-1 NAA and 1, 2.5 and 5 mg L^-1 TDZ). The quality of the formed callus and the most important secondary compounds were analyzed using Gas chromatography–mass spectrometry (GC–MS)and Fourier-transform infrared spectroscopy (FTIR).The MS media(murashige and skoog) supplemented with 1 mg L^-1 NAA + 2.5 mg L^-1 TDZ and 2 mg L^-1 NAA + 5 mg L^-1 TDZ was most effective for callus formation, with the short period of time and the highest percentages of callus formation and fresh weight.GC-MS analysis identified various active compounds in the jojoba plant callus. The callus tissue contained a wide range of secondary metabolic compounds, including ethylene diol, sitosterol, vaccenic acid and ethyl ester methyl mannose, which all exhibit antioxidant activity.FTIR method was integrated to the spectrophotometric system to detect characteristic peak values and functional groups. Chemical compounds included the main functional groups such as phenols, alkanes, amine salts, benzenoid and sulfoxide compounds, primary amine groups and a class of halocarbon compounds. The jojoba plant can be propagated by ex vivo under the influence of plant growth regulators, producing secondary and chemical compounds significant in industrial and medical applications.

First Record of Mugilicola bulbosa Tripathi, 1960 (Ergasilidae: Cyclopoida) on the Gills of Greenback Mullet Planiliza subviridis (Valenciennes) from Shatt Al-Arab River, Southern Iraq

Musshaf H. Al-Mosawi — 2024-12-31

Occurrence and some ecological aspects of Mugilicola bulbosa Tripathi, 1960 were studied. A total of 63 specimens of Planiliza subviridis (Valenciennes) were collected from Garmat Ali River, Basrah Province. (30° 34′ to 30° 35′ N; 47° 44′ to 47° 34 E′) from October 2023 till January 2024. The copepod was recorded from the gill arches during three months. Total body length was 3.686-4.069 (3.875) mm. Statistical analysis showed no significant differences between males and females of fish host in all the studied traits. The highest prevalence of infestation was recorded in November (35%), while the lowest value was during October (0%). The high intensity of infestation was recorded during December (2.6), while the lowest intensity was in October (no fishes were infected). The high intensity and prevalence of infestation appear in the longest group of fishes (15-21cm). Mean length of egg sac (1.3) mm, of this mesoparasite represents the second species of Mugilicola from P. subviridis. The finding of M. bulbosa in Iraq represents a new geographical record for the species.

Influence of Bio-fertilization on Physical and Biochemical Parameters of Grapefruit Saplings Citrus paradisi Macfad. Under Salt Stress

Sabaa J. Abdulkadhim — 2024-12-31

The experiment was conducted in a partially shaded area (50% shade-net) throughout the 2023 growing season. This experiment aimed to know the role of biofertilization in increasing the ability of grapefruit seedlings to tolerate salt stress. Biofertilizers were applied with four levels (without biofertilizers, mycorrhizal fungi, bacteria, and mycorrhizae + bacteria). 20 g of mycorrhizal fungi were added near the saplings roots. 20 ml of bacteria were injected into the soil and in contact with the root zone. Adding 20 g of mycorrhizal fungi + 20 ml of bacteria to the pots soil at the same time and near the roots of the saplings carried out the mycorrhizae + bacteria treatment. Saplings were watered with three concentrations of saline water (2¸ 4¸ and 6 ds.m^-lNaCl₂). The results indicated that at the 6 ds.m^-1level, there was a reduction in physical and biochemical parameters. This decrease is accompanied with an increase in proline, Cl%, and Na%. The integration of mycorrhizal fungus and Azospirillum bacteria showed a significant superiority in root and shoot growth. Biofertilization caused increase the content of carbohydrates, protein, and chlorophyll in plants. Also, obtained result showed increase the content of some macro and micro- elements in plants such as N, P, K, Zn and Fe. While the percentage of Cl and Na and proline content decreased, resulting reduced the damages of salt stress.

Molecular Characterization of the CYTB Gene of Radix auricularia Linnaeus, 1758 (Mollusca, Gastropoda, Lymnaeidae) in Al-Chibayish of Thi-Qar Province, Southern Iraq

Sarmad A. M. Al-Asadi — 2024-12-31

Radix auricularia (R. auricularia) is widely distributed in Iraq, including Al-Chibayish marshes and found to be in many morphs. The study aimed to determine the regions of the mitochondrial genome of R. auricularia documented in NCBI and analyze the CYTB gene using bioinformatic tools. From November 2023 to May 2024, R. auricularia snails (480) were collected from six stations (A to F) in the Euphrates River in Al-Chibayish and had morphometric measurement variations. DNA was extracted from the station snails and the partial CYTB gene was amplified. For sequencing, four purified PCR products (approximately 400 bp) were randomly selected for each station. The bioinformatics results showed that the mitochondrial genome of R. auricularia contained 24 non-protein-coding genes and 13 protein-coding genes, including CYTB, NAD5, NAD6 and NAD4L. The protein-coding genes were divided into two groups, overlapping (30.77%) and non-overlapping (69.23%). The CYTB and NAD4L genes partially overlapped and the NAD6 and NAD5 genes partially overlapped as well. The highest shell measurements were noted in the A station snails followed by E, C, F, B and D stations. Six unique haplotypes (H1 to H6) were identified in Al-Chibayish based on this portion of the CYTB gene. H1 was common and was distributed across five stations (A, C, D, E and F) whereas H2 and H3 were only found in the B station. However, H4, H5 and H6 were limited to the C, D and E stations, respectively. H1 and H4 were identical at amino acid levels. Similarly, H2 and H5 were also identical but H3 and H6 were partially identical. The partially overlapped CYTB gene is a suitable molecular marker in the identification of infraspecific R. auricularia snails in Al-Chibayish and could be broadly applied in the intraspecies recognition of molluscan taxa

The Effect of Moldboard Plowing Speed on The Physical Properties of The Topsoil and Subsoil layers

Dheyaa S. Ashour — 2024-12-31

The soil compaction of moldboard plowing appears as a plow pan, which causes many problems such as resisting root growth, lowering drainage and degrading of soil structure. This study was carried out to determine the effect of surface tillage via using the moldboard plow of 30 cm depth under three operational speeds {S₁=0.49, S₂ =0.74, and S₃ =1.05 m.s^-1} on the soil bulk density ( ), total porosity (f) and penetration resistance (P.R). Soil property of three depths with intervals 10 cm were measured for two positions: {topsoil depth (Td) which represent 0-10, 10-20, and 20-30 cm and subsoil depth (Sd) which represent 30-40, 40-50 and 50-60 cm}. The study results indicated that the lowest values for (0.86 and 0.69 Mg.m^-3) and P.R (983.61 and 118.44 kN.m^-2), and the highest values for f (67.52% and 74.05%), were recorded under the treatments of S₃, and Td, respectively. The soil depth has a significant effect on the P.R only; the D₁ reached the lowest value (861.47 kN.m^-2). The overlapping of S₃×Td has recorded the lowest values for (0.51 Mg.m^-3) and P.R (106.42 kN.m^-2) and the highest value for f (80.82%). The moldboard plow disturbed the topsoil aggregates so that the Td was more homogeneous forces (no significant differences between its depths). However, the weights of the soil depths of 0-10, 10-20, 20-30, 30-40 and 40-50 cm were accumulate on the (50-60cm) which get the highest value of (1.34 Mg.m^-3) and P.R (2561.78 kN.m^-2), and the lowest value of f (49.46%). The triple interaction was significant with regard to and f only. The treatment S₃TdD₃ recorded the lowest value for (66.67%) and the highest value for f (82.48%) compared the treatment of S₂SdD₃, which reached the highest and the lowest f.

Evaluation of the Biochemical and Antioxidant Behaviour of Four Species Chenopodium quinoa Willd, Zea mays L., Triticosecale wittmack and Hordeum vulgare L. Effected by Oxidative Stress Caused by Water Stress

Bouchareb Radia — 2024-12-31

Our study was conducted at the faculty of Sciences of the nature and life from Mentouri Brothers University of Constantine, (36°21′54″ N: 6°36′52″ E), altitude above sea level by 574 m in March 2022. Cereals and pseudo-cereals, the world's most important crop, are an important source of sustenance for humans and animals. In addition, they are distinguished by their high tolerance to abiotic stressors. Hydrological deficit is a major factor limiting agricultural production; the impact varies according to the species, the stage of development of the plant and the severity of the stress. This research aims to evaluate the impact of water stress on H₂O₂ and Malondialdehyde MDA adaptation mechanisms, as well as the quantification of proteins, glycine betaine, phenols and flavonoids that can affect drought in three local species (Triticale, Barley and Maize) and one exotic plant (Quinoa). We also recorded an induced increase in triticale, barley, maize and quinoa stressed in Hydrogen Peroxide (H₂O₂), Malondialdehyde (MDA), proteins and glycine betaine with a concentration varied from 228.75 and 404.58 µmol.g^-1 FM, 4.92 and 20.84 µmol.g^-1DM, 1.35 and 3.21 mg.g^-1FM, 0.34 and 0.54mg.g^-1DM, respectively. While the concentration of flavonoids and phenols total was recorded in maize by 20.14 mg QE g^-1DM and 375.47 mg GAE g^-1DM, respectively. Moreover, it reduced in triticale, barley and quinoa, with a value of 4.26-9.9 mg. EQ g^-1DM and 185.97-421.31 mg. EAGg^-1DM. The study demonstrated the species' resistance to and effectiveness in the face of water stress.

Enhancing Germination and Seedling Growth in Salt Stressed Maize Lines through Chemical Priming

Bolaji U. Olayinka — 2024-12-31

This study aimed to investigate the tolerance level and the use of primers (H₂O, KNO₃, ascorbic acid and salicylic acid), in mitigating stress in maize in the newly released cultivars (SWAN-LSR-Y, BR9928-OMR-SR-Y and OMR-LSR-SY). Activities of SOD, APX, CAT and GSH and lipid peroxidation were investigated, to measure the biochemical response of the primed maize seeds. Maize seeds primed with KNO₃ and ascorbic acid improved germination and anti-oxidative potential against ROS in ameliorating the salinity stress, while salicylic acid slowed germination. The same trend was followed in the seed vigour index and radicle length of seeds primed with ascorbic acid, which recorded the highest values. The control was observed to have the highest seed vigour index, while seeds primed with salicylic acid showed the least vigour index in the maize seeds. Increased salinity stress showed adverse effects on all growth parameters. Of the maize cultivars tested, SWAN-LSR-Y showed the most tolerance to salinity stress, in terms of germination. Significant high enzymatic activities and lipid peroxidation were recorded in seeds primed with ascorbic acid and KNO₃ show their importance in plant metabolic activities.

Improving the Quality Characteristics of Low-Fat Beef Burgers by Adding Different Levels of Rice Bran as a Source of Fibre

Nawar A.A. Al-Ghabawi — 2024-12-31

The study aims at improving the quality characteristics of low-fat beef burgers. This is done by adding rice bran due to its high fibre content, which reached 40.27%. The burger was prepared using four treatments: the first treatment was a control treatment, the second treatment was through adding rice bran by 10%, the third treatment by 20%, and the fourth treatment by 30%. The chemical content of the product was thoroughly studied. The product was stored in the freezer (-18 ±2) for 90 days. during which some qualitative characteristics were monitored, including moisture, protein, fat, ash, carbohydrates, fibre, and cholesterol. As well as the physical characteristics, which included water holding capacity, loss by dissolving, loss by cooking, shrinkage by diameter, cooking yield, retained moisture, and retained fat. Chemical indicators included thiobarbituric acid and sensory characteristics, as well as color, flavor, tenderness, juiciness, and general acceptability. The results brought to light an increase in the fibre content in the burger prepared by increasing the addition of rice bran. It increased from 10.52% when 10% rice bran to 14.12% and 18.88% when rise adding rice bran to 20% and 30% respectively. The concentration of cholesterol decreased from 68.96 in control to 64.57, 61.86 and 57.43 mg.100^-1 gm^-1 when adding 10%, 20% and 30% rice bran respectively. Thiobarbituric acid decreased from 0.48 in control to 0.28 m.kg^-1when adding 30%. The loss after thawing, the cooking, and the shrinkage in diameter was also decreased with adding rice bran. The ability to hold water, the cooking yield, the percentage of retained moisture, and retained fat also increased. The duration of storage also had a significant (p<0.05) effect on the studied traits. The treatments to which rice bran was added also obtained acceptable evaluation scores, close to the evaluation scores of the control treatment. Especially the treatments to which 20% rice bran was added. The results disclosed that the addition of rice bran improved all quality characteristics of the product.

The Effect of Water Magnetization of Different Locations in Basrah Province on the Productive and Physiological Performance of Local Ducks

Sabah K. M. Al-hummod — 2024-12-31

The objective of this study is to evaluate the impact of water magnetization technology from various locations in Basrah province on the productive and physiological performance of local ducks. A total of 105 one-day-old, unsexed local ducks were randomly distributed into seven treatments with three replicates per each (5 birds per replicate). The control treatment used reverse osmosis (RO) water. The treatments were: T1: tap water from Zubair city; T2: magnetized tap water from Zubair city; T3: tap water from Ashar City; T4: magnetized tap water from Ashar City; T5: tap water from Qurna city; T6: magnetized tap water from Qurna city. The results showed a significant improvement in overall body weight, weight gain, feed intake, and feed conversion ratio in both the second and control treatments. The second treatment also recorded the highest overall drinking water consumption. Additionally, higher values of red blood cells (RBC), hemoglobin concentration (Hb), packed cell volume (PCV) were observed. The control treatment recorded a lower value of heterophils/ lymphocyte ratio (H/L) compared to other treatments. Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC) were unaffected by variations in water treatments. The use of magnetic water treatment led to a decrease in the concentration of cholesterol, urea, aspartate aminotransferase (AST), and alanine aminotransferase (ALT) enzymes in the blood serum. Conversely, the use of magnetic water led to a significant (p ≤ 0.05) increase in the glucose, total protein, albumin, and globulin concentrations. In conclusion, the utilization of magnetic treatment in drinking water improved the productive and physiological performance of domestic ducks.

Genetic Variation and Bottleneck Tests in Iraqi Native Cows of Babylon Province by STR Markers

Hayder R. Alnajm — 2024-12-31

In the current study, we evaluated genetic variation and bottleneck analyses of Iraqi native cows in three locations of Babylon province. A total of 70 individuals of three cows' population were genotyped using ten the short tandem repeat markers (STR). The STR loci showed high variation of polymorphism. The average total number of alleles (TNA) and effective number of alleles (Ae) values were 5.30± 0.17 and 3.89± 0.11, respectively. The TNA at the marker level ranged from 3.00 (ETH3) to 8.00 (TGLA227), while the Ae ranged from 2.69 (ETH3) to 5.54 (TGLA227). The Shannon index (I) at the marker level ranged from 1.05 (ETH3) to 1.87 (TGLA227), with mean 1.48± 0.28. Also, the mean polymorphism information content (PIC) was 0.65±0.15, with a range of 0.54 (ETH3) to 0.81 (TGLA227). The average observed heterozygosity (Obs_Het) was 0.54 ± 0.18 and varied from 0.16 (ETH3) to 0.77 (TGLA53). The average expected heterozygosity (Exp_Het) was 0.75±0.25, with a range of 0.62 (ETH3) to 0.85 (TGLA227). The means HS unbiased gene diversity, and inbreeding coefficient (F_IS) were 0.73±0.23, and 0.24±0.09, respectively. The mean Fis, Fit and Fst, and gene flow (Nm) were 0.296 ± 0.065, 0.314 ± 0.090, 0.032 ± 0.002, and 7.259 ± 2.113 respectively. The native cow's population is not at bottleneck, and normal L-shaped distribution of allele frequencies, that it has not experienced any recent decline in effective population size and has remained in equilibrium between mutation and drift. The Bayesian analysis showed that all animals were heterogeneous and formed three distinct clusters.

A Comparative Analysis of Biochemical Indicators for air pollution in three Species Tree Planted Within the Greenbelt Project in Karbala province, Iraq

Jaafar H. Al-Hamd — 2024-12-31

This study was undertaken to represent the December 2023 (Winter) and July 2024 (Summer) within the administrative confines of Karbala governorate, as part of the Southern Greenbelt Project. Three segments of the green belt were chosen to exemplify the environmental diversity of the area. The research report examined three extensively cultivated plant species in the study area: olive (Olea europaea), eucalyptus (Eucalyptus camaldulensis), and date palm (Phoenix dactylifera), to evaluate their efficacy in tolerating air pollution. Plants underwent APTI analysis using four biochemical parameters: total chlorophyll concentration, pH, relative water content (RWC), and ascorbic acid levels. This research aims to evaluate the tree species planted in the Southern Green Belt Project and to compare their effectiveness in mitigating air pollution, assessing their appropriateness for greenbelt initiatives. The aim of the research is to examine the efficacy of these plants in tolerating air pollutants. The findings indicated a substantial disparity between the locations and the seasons. The Air Pollution Tolerance Index for the eucalyptus plant had the highest APTI value, followed by the olive and palm species. The December 2023 yields superior outcomes compared to July 2024 for all plants. The distinction among plants based on the intensity of pollution to which they are subjected and the varying temperatures between seasons.

Complete Genome Sequence of Turnip yellows polerovirus from Iraq: Insight into the Factors Affecting the Genetic Variability of TuYV Populations

Muhannad Al-Waeli — 2024-12-31

Turnip yellows virus (TuYV), is one of the most important viruses belonging to the Polerovirus genus. Incidence, genetic variability, and population structure of TuYV have not yet been studied in mid-Eurasia Iraq. Different brassica fields in Babylon, Basrah, Najaf, and Qadisiyeh provinces of Iraq were surveyed for TuYV infection. A total of 149 symptomatic leaf samples were checked for TuYV infection using reverse transcription polymerase chain reaction (RT-PCR). Furthermore, total RNA from three symptomatic rapeseed (Brassica napus) leaf samples from Basrah-Iraq was used for RNA-Seq. The diversity and population structure of TuYV and the evolutionary forces that shape these populations have been considered. High prevalence infections (52.34%) of TuYV were detected in surveyed fields. An Iraqi isolate was fully sequenced and showed the highest identity 92.68% to a Swedish isolate. Full genome sequences indicated two main phylogroups, however, using ORF0, TuYV isolates clustered in four clades. Clade I was further divided into two subclades (IA and IB), where the Iraqi isolate fell into IB. The recent distribution of TuYV populations in GI and GIII can be inferred from high haplotype diversity and low genetic differentiation. The Fst and Nm values indicate that the gene flow was low, thus the opportunity for divergence in populations via genetic drift is enhanced. By selective pressure, it was found that amino acid substitutions also contribute to TuYV evolution. This is the first evidence of the TuYV full genome sequence in mid-Eurasian Iraq and highlights the importance of recombination and selection pressure in the evolution of TuYV. Analysis of these variations is necessary for making advances in control strategies of viral diseases to prevent their spread.

Morphological and Molecular study of Seven New Recorded of Ostracod in - Kurdistan Region, Iraq

Berivan A. Latef — 2024-12-31

The current study conducted the first characterization of morphological and molecular of seven Ostracoda species new to Iraqi fauna which are; Heterocypris salina, H. spadix, Dolerocypris sinensis, Cyprinotus unoi, Eucypris virens, Sclerocypris exserta and Notodromas monacha that belongs to two families (Cyprididae and Notodromatidadae) collected from 17 different sites which are stream, lakes and rivers in the boundary of Province, from September 2021 to October 2022. For biological purposes, samples of aquatic shore plants (Cynodon dactylon, Polygonum sp., Nerium oleander and Nasturtium officinale), algal municipal (Anabaena and Chlorella vulgaris), were also collected zooplanktonic net was used in the sampling mesh-size (55 μm pore size).Samples placed in an oxygen instrument for about one week after being transformed into the laboratory to allow the ostracod species to grow. After the maturation period, adult species were fixed (were preserved) in 70% and 100% ethanol for morphological and molecular analysis respectively. PCR product of COI was sequenced using forward primer COI F 5'(ACCCGCTGAATTTAAGCAT)3' and reverse primer COIR 5'( CTCTTCAGATACTTTTCAAC) 3' then registered in the GenBank database with their accession numbers. The phylogenetic tree was constructed; the studied species were recognized (as new records to the Iraqi fauna of ostracods) and described from Iraq for the first time. The goal of present study is the molecular study the species besides the phenotypic identification for more accurate taxonomic results.

Genetic Relationships Analysis of Some various Species Using Cytochrome b Genes as a Phylogenetic Marker

Lajan Salahaldin Ahmed — 2024-12-31

This study examined the genetic relationships among six species—chicken (Gallus gallus), quail (Coturnix coturnix), duck (Anas platyrhynchos), goose (Anseranser domestica), and turkey (Meleagris gallopavo) and rabbit (Lepus capensis), using partial mitochondrial cytochrome b (Cyt-b) gene sequences. PCR amplification of the mitochondrial Cyt-b gene resulted in an approximately 358 bp amplicon in size for all species, and sequences alignment and phylogenetic analyses were performed with Bio Edit and MEGA X software’s to determine genetic similarities and distances. Results revealed high nucleotide similarity between chicken and quail (89.1%) and chicken and turkey (83.6%). The closest genetic relationship was between duck and domestic goose, with 87.4% identity and the smallest genetic distance of 0.126. Chicken (Gallus gallus) demonstrated a relatively close relationship with both duck and domestic goose, with identities (83.6%). While, Turkey (Meleagris gallopavo) exhibited a slightly more distant relationship with avian species, with the lowest similarity at 81.6% with domestic goose. The rabbit, positioned at the root of the phylogenetic tree, exhibited the greatest genetic distance from avian species, with a 28.3% distance and 71.7% identity with chicken. This study provides solid evidence of the effectiveness of using Cyt-b gene sequences as a reliable tool for species identification across various applications, underscoring the effectiveness of partial Cyt-b gene sequences for avian species identification and genetic analysis, which is valuable for breeding and diversity studies.

Biosynthesis of Iron Oxide Nanoparticles Using Food Origin Citrobacter freundii in Optimized Conditions

Marwa H. AlKhafaji — 2024-12-31

Sustainability, Ecofriendly, and green technology are key principles guiding the biosynthesis of nanoparticles in this research. This work aimed to utilize Iron oxide nanoparticles (IONPs) as antimicrobial agents, what offers a promising solution to combat antibiotic-resistant pathogens. In this study, 120 food samples were analyzed. Food origin Citrobacter freundii was isolated and identified accurately to be used then for the biosynthesis of Iron oxide nanoparticles. Iron Oxide Nanoparticles were synthesized and characterized using different assays. Atomic force microscope was the principle characterization technique. Their antimicrobial activity was tested against foodborne and clinical bacterial isolates. The results of this study revealed that the biosynthesized IONPs were in a diameter of 32.86 nm with magnetic properties. The biosynthesized IONPs inhibited the biofilm formation of both food and clinical isolates. The main conclusion of this work is that food origin C. freundii is an excellent reducing agent in the biosynthesis of these bioactive nano-scale materials. This research is the first to synthesize Ferric oxide NPs using C. freundii marking a new approach in the field. Clinical C. freundii required a higher IO-NPs dose more than foodborne isolates. This calls for stronger therapies, while foodborne C. freundii still poses contamination risks despite lower resistance. Addressing both could improve antimicrobial treatments and food safety.

Effects Bacterial Inoculation and organic Fertilization on Some Soil Properties and Growth oF Potato Crop Role in Sustainable Agriculture

Haider A. Al-Maamori — 2024-12-31

A field experiment was carried out at the Agricultural Research Station in Wasit Governorate, with a design of RCBD this study aimed to determine the role of Bacillus, Azotobacter, and organic fertilizers on soil biological and chemical properties and potato growth indicators. The results of the application experiment showed that the mixed treatment with Azotobacter chroococcum + Bacillus megaterium bacteria was superior in terms of the number of Bacillus bacteria in the soil, the number of Azotobacter bacteria in the soil, the soil pH, the leaf area, the tuber weight,and the yield per plant (7.48×10⁶, 8.42×10⁶cfu, 7.03, 1.92%, 13416 cm², 129.10 gm, respectively). The organic fertilizer vermicompost was also superior in terms of the number of Bacillus bacteria in the soil, the number of Azotobacter bacteria in the soil, the soil reactivity, the leaf area, the tuber weight, and the yield per plant (4.45×10⁶, 5.58×10⁶, 7.05, 1.92%, 13434 cm², 136.90 gm, 1386.7 gm, respectively).

Utilization of Locally Available Substrates And Their Effect on the Growth And Yield of Cauliflower (Brassica oleracea botrytis group) Microgreens

Aeron H. R. Rabago — 2024-12-31

The present study was conducted to investigate the effects of substrates on the growth and production of cauliflower microgreens (Brassica oleracea botrytis group), Two varieties (Makita and Moonlight) were grown in different substrates consisting of cocopeat, carbonized rice hull (CRH), perlite with cocopeat (equal parts) and vermiculite and were harvested 6 days after emergence. The study was conducted under ambient conditions (temperature: 28 ± 2 °C and relative humidity: 65 ± 5%) for 8 days of cultivation from sowing. The results showed that the types of substrates significantly affect the growth and production of cauliflower microgreens. Based on the effects of substrates on each variety, for the Makita variety, perlite with cocopeat showed longer roots and similar fresh weight compared to CRH. While Moonlight variety showed taller microgreens, longer hypocotyls, and longer leaves when grown in perlite with cocopeat medium compared to other substrates. Moreover, the fresh weight of microgreens grown in perlite with cocopeat was higher compared to cocopeat and CRH, Perlite with cocopeat and cocopeat showed higher yields which were similarly higher than vermiculite and CRH. Substrates did not record a significant effect on total soluble solids for both varieties, On the other hand, Moonlight yields outperformed Makita yields, especially in perlite with cocopeat substrate which also recorded better growth for Moonlight Hence for high-yielding microgreens.a

Endometrial Mucin-1 Expression Increases In Mid-Diestrus Following PG-600 Administration in sheep

Hayder M.H. Habeeb — 2024-12-31

Mucin-1 (MUC-1) is an anti-adhesion glycoprotein expressed on the apical surface of the endometrial luminal and glandular epithelium which prevents interactions between the trophectoderm and endometrial epithelium. The aim of this study was to investigate the outcome of PG-600 on ovine endometrial MUC-1 immunoexpression during early and mid-diestrus. Twenty-four cycling ewes (Polypay) were administered progesterone for 9 days. Two days before progesterone withdrawal, ewes were treated with cloprostenol. At progesterone withdrawal (d0), ewes were treated with either PG-600 (5 mL) or saline (5 mL) group. Endometrial tissues were collected surgically on days 4 and 7 after PG-600 or saline (n=6/group/timepoint) and were subjected to immunohistochemistry followed by image acquisition. Stained area for MUC-1 was quantified using Image J. The diestrous intercaruncular endometrium of both treated and control ewes expressed MUC-1. However, the percent area expressing MUC-1 varied between endometrial area (luminal and superficial glandular epithelium), time (day four, day 7), and treatment group. PG-600 treatment increased MUC-1 expression in the luminal epithelium on day 7 and in the superficial glandular epithelium expression on day 4. The results of this study show that administration of PG-600 to ewes increases endometrial MUC-1 expression in mid diestrus, which provides a possible mechanism for lower fertility found following treatment by PG-600 in sheep.

Study on Parameters Related to Growth, Yield, and Quality of Strawberry Plants (Fragaria vesca L.) Grown Hydroponically and in Soil

Le Thi Thuy — 2024-12-31

This study evaluated the effects of soil and hydroponic cultivation on the growth, yield, and quality parameters of Hana strawberry plants (Fragaria vesca L.). In the hydroponics method, four nutrient solutions were used: an inorganic Hydro Umat F solution, two types of organic solutions (fish-based soluble fertilizer and Vermicompost soluble fertilizer), and a combination of organic and inorganic nutrients (Hydro Umat F solution and Banana soluble fertilizer in a 1:1 ratio). TN1 substrate was combined with additional fertilization of fish- based soluble fertilizer, which was used in the experiment of growing plants in soil. The results showed that hydroponic cultivation using the Hydro Umat F solution promoted better growth than the other three nutrient solutions, and soil. Specifically, strawberry plants grown in the Hydro Umat F solution had the highest number of leaves per plant, stolons per plant and the largest leaflet size in the experimental groups. Conversely, soil cultivation resulted in higher yield and quality of Hana strawberries, as indicated by parameters such as the number of flowers per plant (29.67) flowers, the number of fruits per plant (20.08) fruits, fruiting rate (67.69)%, fresh weight of fruit (16.25 g), vitamin C content (66.7) mg.100g^-1 fresh weigh, total organic acid content (159.31) mg.100g^-1 fresh weight and sweetness index (11.08) ^oBrix. The results also showed that hydroponic cultivation with organic solutions reduced the growth and yield of Hana strawberry plants compared to inorganic solutions.

Advancements in Crop Water Modelling: Algorithmic Developments and Parameter Optimization Strategies for Sustainable Agriculture: A Review

Ahmad S. S. Sulaiman — 2024-12-31

This paper presents a review on algorithm development and crop water modelling with a focus on optimizing significant parameters related to crop factors, soil factors, and weather factors. The accurate representation and optimization of these parameters are crucial for reliable predictions and effective decision-making in agricultural practices. The objective of this review is to analyse the existing literature on algorithm development, parameter optimization techniques, and their application in crop water modelling, specifically emphasizing the importance of crop factors, soil factors, and weather factors. The review concludes with a discussion on the key findings and future directions in algorithm development and optimization for crop water modelling. It highlights potential research gaps and challenges that need to be addressed to improve the accuracy and efficiency of crop water modelling. The impact of optimized modelling approaches on sustainable agricultural practices and water management is also discussed. Overall, this comprehensive review provides valuable insights into the importance of algorithm development, optimization, and parameter selection in crop water modelling, specifically focusing on crop factors, soil factors, and weather factors.

Sustainable Innovations in Steam Generation for Food Sterilization Processes: A Review

Atheer Abdul Amir Al-Mtury — 2024-12-31

The current review aimed to identify the recent developments in sustainable steam generation and its applications in food sterilization. Fuel, gas, and coal boilers are the traditional methods for producing steam. Recently, innovative methods of steam generation include electrodes, solar, natural gas, nano-electric, biogas, biomethane boilers, and sustainable steam generation through heat pump (heat pump is an energy-efficient device that transfers heat from one location to another, typically using electricity). The calories in the 100% saturated steam are higher than steam saturation by 95%. The solar parabolic dish system includes biaxial tracking mechanism that ensures increased efficiency and useful energy production due to the increased radiation. Electrode boilers generate steam using electric current, offering simplicity, reliability, and efficiency. Nano-electric boiler boasts a high-power density, minimal carbon emissions, great physical stability, and high-power factor and electric conversion efficiency. The efficiency of natural gas, biogas and biomethane boilers ranges from 94% to 95% with an economizer. The air-source heat pump boiler provides stable system output with high energy efficiency, generating steam at temperatures exceeding 120°C. Water content below 0.01% mass is necessary for steam purity to prevent overheating. The thermal treatment of canned food should reduce bacteria levels by 12 log cycles in low-acid foods to meet safety limits. The container contains 1 spores for Clostridium botulinum for thermal treatment (sterilization) at 121°C. The process involves sterilizing materials at 121°C for 15 min, killing most heat-resistant microorganisms. The innovative steam sterilization methods aim to advance industrial uses that fulfill net-zero emissions and sustainable development goals (SDG).

Revolutionizing Agriculture: A Comprehensive Review of AI-Enabled Precision Irrigation and Water Quality Forecasting

Hajar Hamdaoui — 2024-12-31

Climate change poses significant challenges to the agricultural sector, exacerbating water scarcity and intensifying the irrational utilization of water reserves. In response to these pressing issues, Artificial Intelligence (AI) optimizes irrigation, predicting water quantity and quality to ensure optimal crop yields. AI-driven approaches mitigate the challenges of water scarcity, enhancing precision in irrigation management. This review explores recent AI applications in irrigation, focusing on three areas: AI-powered estimation of Crop Evapotranspiration (ETo), integration of AI with Interet of Things (IoT) for Smart Irrigation Systems (Smart-IS), and AI's role in forecasting water quality for irrigation. AI algorithms optimize water usage by quantifying water needs, enabling real-time monitoring, autonomous decision-making, and mitigating risks associated with poor water quality, thus enhancing crop productivity while minimizing environmental impacts. This review emphasizes AI's role in addressing water scarcity and optimizing irrigation in agriculture by utilizing different technologies to ensure sustainable water management and food security. Future researchers will find this review valuable for understanding AI's current impact on irrigation and identifying avenues for further innovation.

Roles of Foliar Fertilization on Growth, Yield and Quality of Tomato (Solanum lycopersicum L.) Cultivars (Review)

Daniel Munda — 2024-12-31

Tomato (Solanum lycopersicum L.) is one of the most important vegetable crops, and it is a source of daily diet and cash crop in Ethiopia. However, its production is affected by nutrient application methods of which foliar fertilization is a popular method. The objective of this review paper is to synthesize literatures on the effects of foliar fertilization on growth, yield and quality of tomato cultivars. Both macro and micronutrient concentrations were evaluated. The articles addressing that foliar fertilization effectively increased growth, yield and quality of tomato cultivars. Foliar fertilization to be effective and maximize crop yield and nutrient uptake, the "right type," "right rate," "right time “and” right place" are essential. The right nutrient selection satisfies crop requirements, and the optimal rate of application avoids stunted development. Applications should be timed for optimal absorption conditions to maximize efficacy and avoid waste by focusing on absorbent plant sections. These elements work together to promote sustainable and effective crop management. Over all, the results showed that with 10,000 ppm of urea fertilization, the Marglobe tomato cultivar achieved a plant height of 155.63 cm, fruit weight of 151 g, and a yield of 63.69 t/ha. Additionally, the findings indicated 9.05 ± 0.32% total soluble solids (TSS) and a chlorophyll content of 51.6 ± 1.31 SPAD values with 100 ppm of ZnO nanoparticles. In conclusion, foliar fertilization of nutrients increased growth, yield and quality of tomato cultivars however, the result vary from cultivar to cultivar. The foliar fertilization depends on appropriate time, weather condition, genotypes of tomato, leaf area index, amount of foliar fertilization, type of nutrient, and stage of crop.