Article Sidebar

Download
PDF
Statistic
Read Counter : 16 Download : 11

Downloads

Download data is not yet available.

Main Article Content

Abstract

The current study conducted the first characterization of morphological and molecular of seven Ostracoda species new to Iraqi fauna which are; Heterocypris salina, H. spadix, Dolerocypris sinensis, Cyprinotus unoi, Eucypris virens, Sclerocypris exserta and Notodromas monacha that belongs to two families (Cyprididae and Notodromatidadae) collected from 17 different sites which are stream, lakes and rivers in the boundary of Province, from September 2021 to October 2022. For biological purposes, samples of aquatic shore plants (Cynodon dactylon, Polygonum sp., Nerium oleander and Nasturtium officinale), algal municipal (Anabaena and Chlorella vulgaris), were also collected zooplanktonic net was used in the sampling mesh-size (55 μm pore size).Samples placed in an oxygen instrument for about one week after being transformed into the laboratory to allow the ostracod species to grow. After the maturation period, adult species were fixed (were preserved) in 70% and 100% ethanol for morphological and molecular analysis respectively. PCR product of COI was sequenced using forward primer COI F 5'(ACCCGCTGAATTTAAGCAT)3' and reverse primer COIR 5'( CTCTTCAGATACTTTTCAAC) 3' then registered  in the GenBank database with their accession numbers. The phylogenetic tree was constructed; the studied species were recognized (as new records to the Iraqi fauna of ostracods) and described from Iraq for the first time. The goal of present study is the molecular study the species besides the phenotypic identification for more accurate taxonomic results.

Keywords

Molecular study Morphology identifications Ostracod PCR Phylogenetic analysis

Article Details

Creative Commons License

This work is licensed under a Creative Commons Attribution 4.0 International License.

How to Cite
Latef, B. A. ., & Ali, L. A. . (2024). Morphological and Molecular study of Seven New Recorded of Ostracod in - Kurdistan Region, Iraq. Basrah Journal of Agricultural Sciences, 37(2), 221–239. Retrieved from https://bjas.bajas.edu.iq/index.php/bjas/article/view/1999
Download Citation
Endnote/Zotero/Mendeley (RIS)
BibTeX

References

  1. Ali, F. S., Yousef, E. A., Hegab, M. H., & Khalifa, N. (2018). Morphological re-description and molecular characterization of Heterocypris salina (Brady, 1868), a new recorded ostracod species in Egypt. Egyptian Journal of Aquatic Biology and Fisheries, 22(3), 37-54. https://doi.org/10.21608/ejabf.2018.8767
  2. Ali, L. A. (2007). A study of macroinvertebrates community in the Middle Sector of Greater Zab River/Iraq. Ph.D. Thesis, , University of Baghdad. 186pp.
  3. Alrubayi, A. A., Almukhtar, E. A., & Alwaily, A. J. (2011). Effects of organic pollution on some fish and benthic macroinvertebrate groups in Rivers Tigris and Diyala at Baghdad area. Baghdad Science Journal, 8(1), 462-470. https://doi.org/10.21123/bsj.2011.8.1.462-470
  4. Bellin, N., Spezzano, R., & Rossi, V. (2021). Assessing the extinction risk of Heterocypris incongruens (Crustacea: Ostracoda) in climate change with sensitivity and uncertainty analysis. Water, 13(13), 1828. https://www.mdpi.com/2073-4441/13/13/1828
  5. Bode, S. N., Adolfsson, S., Lamatsch, D. K., Martins, M. J., Schmit, O., Vandekerkhove, J., Mezquita, F., Namiotko, T., Rossetti, G., Schön, I., Butlin, R. K., & Martens, K. (2010). Exceptional cryptic diversity and multiple origins of parthenogenesis in a freshwater ostracod. Molecular Phylogenetics and Evolution, 54(2), 542-552. https://doi.org/10.1016/j.ympev.2009.08.022
  6. Brandão, S. N. A., L.S., Nery, D. G., Pereira, J. S., & Praxedes, R. A. S., S.G. Karanovic, I. . (2024). World Ostracoda Database. Accessed at https://www.marinespecies.org/ostracoda. https://doi.org/doi:10.14284/364
  7. Costa, F., Dewaard, J., Boutillier, J., Ratnasingham, S., Dooh, R., Hajibabaei, M., & Hebert, P. (2007). Biological identifications through DNA barcodes: The case of the Crustacea. Canadian Journal of Fisheries and Aquatic Sciences, 64, 272-295. https://doi.org/10.1139/f07-008
  8. Czajkowska, M. (2022). High-resolution environmental changes recorded in ostracod and mollusc fauna from the Holsteinian palaeolake at Ortel Królewski II, eastern Poland. Boreas, 51(4), 793-809. https://doi.org/10.1111/bor.12588
  9. Dhahir, S. F., & Ali, L. A.-Q. (2017). A study of zooplankton community in Dukan Lake, Kurdistan Region-Iraq, with a new record of Craspedacusta sowerbii Lankester (1880) Medusa (Cnidaria: Hydrozoa). Baghdad Science Journal, 14(4), 0735. https://doi.org/10.21123/bsj.2017.14.4.0735
  10. Dung, B. T., Doanh, P. N., The, D. T., Loan, H. T., Losson, B., & Caron, Y. (2013). Morphological and molecular characterization of lymnaeid snails and their potential role in transmission of Fasciola spp. in Vietnam. The Korean Journal of Parasitology, 51(6), 657-662. https://doi.org/10.3347/kjp.2013.51.6.657
  11. Echeverría-Galindo, P., Anslan, S., Frenzel, P., Künzel, S., Vences, M., Pérez, L., Börner, N., Kang, W., Schwarz, A., Wang, J., Peng, P., Zhu, L., & Schwalb, A. (2021). High-throughput identification of non-marine Ostracoda from the Tibetan Plateau: Evaluating the success of various primers on sedimentary DNA samples. Environmental DNA, 3(5), 982-996. https://doi.org/https://doi.org/10.1002/edn3.222
  12. Kakui, K., Munakata, M., Tanaka, H., & Hiruta, C. (2021). Mismatch between similarity of mitochondrial gene order and phylogenetic distance in Podocopa (Crustacea: Ostracoda). Zoologischer Anzeiger, 293, 145-148. https://doi.org/https://doi.org/10.1016/j.jcz.2021.05.011
  13. Kalpana, R., Bhavan, P., Udayasuriyan, R., Sheu, J. R., Thanasekaran, J., & Fong, T. H. (2021). First record of a seed shrimp (Ostracoda: Podocopida) Cypretta campechensis (Cyprididae) in a perennial lake (Coimbatore, India): Its molecular identification. International Journal of Fauna and Biological Studies, 8, 40-53. https://doi.org/10.22271/23940522.2021.v8.i2a.810
  14. Karanovic, I. (2012). Recent freshwater ostracods of the world: Crustacea, Ostracoda, Podocopida. Springer Berlin, Heidelberg, 610pp. https://doi.org/https://doi.org/10.1007/978-3-642-21810-1
  15. Khalifa, M. G., & Ajeel, S. G. (2022). New record of Cypridopsis vidua (Muller, 1776) (Ostracoda, Podocopida: Cyprididae) from East Al-Hammar Marshes, Iraq. International Journal of Aquatic Biology, 10(4), 299-302. https://doi.org/10.22034/ijab.v10i4.1712
  16. Koyee, Q. M. K., & Abdullah, S. M. A. (2023). First Morphological and Molecular (28S rDNA) Characterization of Eudiplozoon nipponicum (Monogenea, Diplozoidae) parasitizing Cyprinus carpio, Kurdistan Region, Iraq. Basrah Journal of Agricultural Sciences, 36(1), 186-200. https://doi.org/10.37077/25200860.2023.36.1.16
  17. Külköylüoğlu, O., Çelikbaş, B., & Ataman, A. (2022). Habitat destruction in wetland affects Ostracoda (Crustacea) species occurrence patterns amid different aquatic habitats. Aquatic Ecology, 56(3), 605-618. https://doi.org/10.1007/s10452-021-09934-6
  18. Külköylüoğlu, O., Yavuzatmaca, M., Akdemir, D., Çelen, E., & Dalkıran, N. (2018). Ecological classification of the freshwater Ostracoda (Crustacea) based on physicochemical properties of waters and habitat preferences. Ann. Limnol. - Int. J. Lim., 54, 26. https://doi.org/10.1051/limn/2018017
  19. Kumar, S., Stecher, G., Li, M., Knyaz, C., & Tamura, K. (2018). MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular biology and evolution, 35(6), 1547-1549. https://doi.org/10.1093/molbev/msy096
  20. Latef, B. A., & Ali, L. A.-Q. (2023). Morphological and Molecular Characterization of Heterocypris incongruens (Ramdohr 1808), A New species ostracod in Kurdistan region-Iraq. Journal of Wildlife and Biodiversity, 7(4), 36-48. https://doi.org/10.5281/zenodo.8147621
  21. Martens, K., Halse, S., & Schon, I. (2012). Nine new species of Bennelongia De Deckker & McKenzie, 1981 (Crustacea, Ostracoda) from Western Australia, with the description of a new subfamily. European Journal of Taxonomy, 8, 1-56. https://doi.org/10.5852/ejt.2012.8
  22. Martens, K., Shribak, M., Arkhipova, I., & Schön, I. (2023). The common morphospecies Cypridopsis vidua (O.F. Müller, 1776) (Crustacea, Ostracoda) is not an obligate parthenogen. Belgian Journal of Zoology, 153. https://doi.org/10.26496/bjz.2023.107
  23. Mesquita-Joanes, F., Aguilar-Alberola, J., Palero, F., & Rueda, J. (2020). A new species of Cypris (Crustacea: Ostracoda) from the Iberian Peninsula and the Balearic Islands, with comments on the first ostracod named using the Linnean system. Zootaxa, 4759, 113-131. https://doi.org/10.11646/zootaxa.4759.1.8
  24. Munakata, M., Tanaka, H., & Kakui, K. (2021). Heterocypris spadix sp. nov. (Crustacea: Ostracoda: Cypridoidea) from Japan, with Information on Its Reproductive Mode. Zoological Science, 38(3), 287-296, 210. https://doi.org/10.2108/zs200127
  25. Pieri, V., Marrone, F., Martens, K., & Rossetti, G. (2020). An updated checklist of recent ostracods (Crustacea: Ostracoda) from inland waters of Sicily and adjacent small islands with notes on their distribution and ecology. The European Zoological Journal, 87, 714-740. https://doi.org/10.1080/24750263.2020.1839581
  26. Quante, E., Pint, A., & Frenzel, P. (2022). Nonmarine Ostracoda as proxies in (geo-)archaeology — A review. Geoarchaeology, 37(5), 711-732. https://doi.org/https://doi.org/10.1002/gea.21912
  27. Smith, R., & Kamiya, T. (2014). The freshwater ostracod (Crustacea) genus Notodromas Lilljeborg, 1853 (Noto-dromadidae) from Japan; Taxonomy, ecology and lifestyle. Zootaxa, 3841, 239-256. https://doi.org/10.11646/zootaxa.3841.2.4
  28. Sulieman, A. M., Idris, A. I., Alshammari, N., Alanazi, N., Al-Azmi, M., Hamadou, W., Albadri, G., & Khamisabadi, H. (2022). The molecular biodiversity of bacteria isolated from Medicago sativa Rhizosphere in Hail District, Saudi Arabia. Cell and Molecular Biology (Noisy-le-grand), 68(2), 1-7. https://doi.org/10.14715/cmb/2022.68.2.1
  29. Szlauer-Lukaszewska, A., Pešić, V., & Zawal, A. (2021). Environmental factors shaping assemblages of ostracods (Crustacea: Ostracoda) in springs situated in the River Krąpiel valley (NW Poland). Knowledge and Management of Aquatic Ecosystems, 422, 1-11. https://doi.org/10.1051/kmae/2021010
  30. Taher, H. M., & Alyousuf, A. (2023). Morphological and molecular identification of jujube fruit fly Carpomya incompleta (Becker, 1903) (Diptera: Tephritidae) southern Iraq. Basrah Journal of Agricultural Sciences, 36(1), 39-49. https://doi.org/10.37077/25200860.2023.36.1.04
  31. Tan, C. W. J., Gouramanis, C., Pham, T. D., Hoang, D. Q., & Switzer, A. D. (2021). Ostracods as pollution indicators in Lap An Lagoon, central Vietnam. Environmental Pollution, 278, 116762. https://doi.org/https://doi.org/10.1016/j.envpol.2021.116762
  32. Tran Van, P., Anselmetti, Y., Bast, J., Dumas, Z., Galtier, N., Jaron, K. S., Martens, K., Parker, D. J., Robinson-Rechavi, M., Schwander, T., Simion, P., & Schön, I. (2021). First annotated draft genomes of nonmarine ostracods (Ostracoda, Crustacea) with different reproductive modes. G3 (Bethesda), 11(4). https://doi.org/10.1093/g3journal/jkab043
  33. Zwair, H. (2021). New record species of freshwater ostracoda from middle of iraq. Nat. Volatiles & Essent. Oils,, 8(4), 12787-12794. https://doi.org/10.26496/bjz.2023.107
  34. Zwair, H. (2023). Perspective Chapter: OstracodaFormation and Evolution of Earth’s Crust. IntechOpen; 2023. http://doi.org/10.5772/intechopen.112211.